Transcription Factors and Their Regulatory Roles in the Male Gametophyte Development of Flowering Plants.

Male gametophyte development in plants relies on the functions of numerous genes, whose expression is regulated by transcription factors (TFs), non-coding RNAs, hormones, and diverse environmental stresses. Several excellent reviews are available that address the genes and enzymes associated with male gametophyte development, especially pollen wall formation. Growing evidence from genetic studies, transcriptome analysis, and gene-by-gene studies suggests that TFs coordinate with epigenetic machinery to regulate the expression of these genes and enzymes for the sequential male gametophyte development. However, very little summarization has been performed to comprehensively review their intricate regulatory roles and discuss their downstream targets and upstream regulators in this unique process. In the present review, we highlight the research progress on the regulatory roles of TF families in the male gametophyte development of flowering plants. The transcriptional regulation, epigenetic control, and other regulators of TFs involved in male gametophyte development are also addressed.

First report of powdery mildew caused by Podosphaera fusca on Coreopsis tinctoria in China.

Coreopsis tinctoria is an annual herb and commonly cultivated in gardens due to its attractive flowers, its capitula also have been used as a traditional medicine in China, Asia, North America and Europe (Shen et al. 2021). In June 2023, severe powdery mildew infection was observed on C. tinctoria in a hillside near headwork of the middle route of the South to North Water Diversion Project (32°40'55''N, 111°41'59''E). Abundant irregular white spots were found on adaxial surface of the leaves and tender stems. Approximately 75% of the observed C. tinctoria plants showed these signs and symptoms. Generative hyphae were thin-walled, smooth or almost so, and 5 to 9 µm wide. Conidiophores were unbranched, straight, 80.5 to 162.5 × 9.3 to 12.9 µm (n=25), and produced one to three immature conidia. Foot-cells of conidiophores were cylindrical, 38.5 to 62.3 µm (n=20) long. Conidia were ellipsoid to ovoid, 25.1 to 31.9 × 15.2 to 19.5 µm (n=30). The morphological characteristics of asexual structures corresponded to Podosphaera sp. (Braun and Cook 2012). For further identification, genomic DNA was extracted directly from the mycelia and conidia using Chelex 100 (Sigma Aldrich, Shanghai, China). The internal transcribed spacer (ITS) regions and 28S large subunit (LSU) of ribosomal DNA from the specimen (CT2302) were amplified using the primers ITS1/ITS4 (expected amplicon size 566 bp) (White et al. 1990) and NL1/NL4 (expected amplicon size 618 bp) (Baten et al. 2014), respectively. The sequences of ITS (GenBank accession no. OR649304) and LSU (GenBank accession no. OR649305) showed 99.63% and 100% identity values to the Podosphaera fusca isolate HMNWAFU-CF2012074 in the NCBI database (KR048109 for ITS and KR048178 for LSU), respectively. Phylogenetic analyses based on the combined ITS and LSU sequences using MEGA 7.0 software indicated that CT2302 formed a monophyletic clade together with isolates of P. fusca. Therefore, this fungus was identified as P. fusca based on the morphological and molecular characteristics. Pathogenicity tests were performed by gently pressing the infected leaves onto 15 young leaves of five healthy plants and three noninoculated plants were used as controls. All plants were maintained in a greenhouse (25℃ and 70% relative humidity). Powdery mildew symptoms similar to those of originally diseased plants were observed on all inoculated leaves after 12 days, whereas no symptoms were observed on the control leaves. Powdery mildew caused by P. fusca (previously Sphaerotheca fusca) on C. tinctoria has been reported in Russia, Poland, Korea, Romania and Ukraine (Cho and Shin 2004; Rusanov and Bulgakow 2008). To our knowledge, this is the first report of P. fusca on C. tinctoria in China. The identification of P. fusca as the causal agent on C. tinctoria is critical to the prevention and control of this disease in the future.

First Report of Leaf Spot Caused by Corynespora cassiicola on Jasminum sambac in Pakistan.

Jasminum sambac L. is a species of jasmine native to a small region in the eastern Himalayas and is cultivated worldwide as an ornamental plant (USDA-ARS 2016). In Pakistan, it is cultivated for ornamental purposes throughout the country. The flowers of this plant are traditionally used in the preparation of essential oils and for making jasmine tea. The flowers and leaves also have been used in folk medicine to treat breast cancer, epilepsy, ulcers and promote wound healing (Al-Snafi 2018). In December, 2017, almost 10 leaves of 3 plants of J. sambac growing plant nursery of Gehlan, Pattoki, Punjab a province of Pakistan were observed with leaf spot disease. Infected leaves exhibited circular to sub-circular spots with indistinct margins and grey papery centers delimited by dark brown rims. For further microscopic study, the infected leaves were examined under a stereomicroscope. For the isolation and cultural studies of infecting fungus, infected parts of leaves were surface sterilized in 1% NaOCl for about 10 seconds, washed twice in sterilized distilled water, plated on potato dextrose agar (PDA) medium and incubated at 25°C for 4 days. Pure cultures were obtained having colonies of light to dark brown color. Conidia (n=20) were light brown to pale olivaceous brown, smooth, obclavate to cylindrical in shape, 99.5-118.5 µm in length and 12.5-15.0 µm in width, with mostly 3 to 14 pseudosepta. Conidiophores (n=20) were straight to slightly curved, unbranched, and pale to light brown in color. Based on the morphological characteristics of the colonies and conidiophores and conidia, the pathogen was identified as Corynespora cassiicola (Berk and M.A. Curtis) C.T. Wei. (Berkeley & Curtis 1968; Lu et al. 2021; Wei 1950). Genomic DNA was extracted following using modified CTAB method (Gardes and Bruns 1993) and internal transcribed spacer (ITS) region was amplified with ITS1 and ITS4 primers (White et al. 1990). The ITS sequence generated of about 553 bp and deposited in GenBank (accession no. MN954556), was found more than 99% similar to previously deposited sequences of C. cassiicola (GenBank accession nos. MN339671, EU364535, FJ852574, MK139711, EU131374) as verified through BLASTn and phylogenetic tree construction. A pathogenicity test was performed for fulfilling Koch'spostulates. Conidial suspension (105 conidia/ml) of the recovered isolate was sprayed on the 5 healthy leaves of 2-month-old seedling of J. sambac. Mock inoculated plants sprayed sterile distilled water were used as a control. The seedlings were covered with plastic bags to maintain high humidity at 24 to 28°C for a week. Identical disease symptoms to those observed in nursery plants were observed on the leaves of the inoculated plants in 7 days but not mock inoculated plants and results were reconfirmed. The reoccurred fungus was isolated from the diseased spots of the inoculated leaves to complete Koch's postulates and identified microscopically. A representative sample of leaves with lesions was deposited in the LAH herbarium, Department of Botany University of the Punjab, Pakistan (LAH35691). Previously, C. cassicola has been found infecting Jasminum mesnyi in China and Jasminum sp. in Florida (Alfieri et al. 1984; Zhang et al. 2018). The best of our knowledge, this is the first report of leaf spot caused by C. cassiicola on J. sambac in Pakistan. It will establish a foundation for future studies of management strategies for this plant disease caused by C. cassiicola.

Molecular confirmation of Coleosporium plumeriae Causing Rust of Plumeria rubra in Mexico.

Frangipani (Plumeria rubra L.; Apocynaceae.) is a deciduous ornamental shrub, native to tropical America and widely distributed in tropical and subtropical regions. In Mexico, P. rubra is also used in traditional medicine and religious ceremonies. In November 2018-2022, rust-diseased leaves of P. rubra were found in Yautepec (18°49'29"N; 99°05'46"W), Morelos, Mexico. Symptoms of the disease included small chlorotic spots on the adaxial surface of the infected leaves, which as the disease progressed turned into necrotic areas surrounded by a chlorotic halo. The chlorotic spots observed on the adaxial leaf surface coincided with numerous erumpent uredinia of bright orange color on the abaxial leaf surface. As a result of the infection, foliar necrosis and leaves abscission was observed. Of the 40 sampled trees, 95% showed symptoms of the disease. On microscopic examination of the fungus, bright orange, subepidermal uredinia were observed, which subsequently faded to white. Urediniospores were bright yellow-orange color. They were ellipsoid or globose, sometimes angular, echinulate, (21.5) 26.5 (33.0) × (16.0) 19.0 (23.0) µm in size. Morphological features of the fungus correspond with previous descriptions of Coleosporium plumeriae by Holcomb and Aime (2010) and Soares et al., (2019). A voucher specimen was deposited in the Herbarium of the Departmet of Plant-Insect Interactions at the Biotic Products Development Center of the National Polytechnic Institute under accession no. IPN 10.0113. Species identity was confirmed by amplifying the 5.8S subunit, the ITS 2 region, and part of the 28S region with rust-specific primer Rust2inv (Aime, 2006) and LR6 (Vilgalys and Hester 1990). The sequence was deposited in GenBank (OQ518406) and showed 100% sequence homology (1435/1477bp) with a reference sequence (MG907225) of C. plumeriae from Plumeria spp. (Aime et al. 2018). Pathogenicity was confirmed by spraying a urediniospores suspension of 2×104 spores ml-1 onto ten plants of P. rubra. Six plants were inoculated and sealed in plastic bags, while four noninoculated plants were applied with sterile distilled water. Plants were inoculated at 25°C and held for 48 h in a dew chamber, after this, the plants were transferred to greenhouse conditions (33/span>2°C). The experiment was performed twice. All inoculated plants developed rust symptoms after 14 days, whereas the non-inoculated plants remained symptomless. The recovered fungus was morphologically identical to that observed in the original diseased plants, thus fulfilling Koch's postulates. According to international databases (Crous 2004; Farr and Rossman 2023), C. plumeriae has not been officially reported in Mexico, despite being a prevalent disease. Diseased plants have been collected and deposited in herbaria, unfortunately, these reports lack important information such as geographic location of sampling, pathogenicity tests, or molecular evidence, which are essential for a comprehensive study of the disease in Mexico. To our knowledge, this is the molecular confirmation of Coleosporium plumeriae causing rust of Plumeria rubra in Mexico. Rust of P. rubra caused by C. plumeriae has been previously identified in India, Taiwan, Malaysia, and Indonesia by Baiswar et al. (2008), Chung et al. (2006), Holcomb and Aime (2010) and Soares et al., (2019). This disease causes important economic losses in nurseries, due to the defoliation of infected plants.

Leaf Spot Caused by Didymella glomerata on Chaihu (Bupleurum falcatum L.) in China.

Bupleurum falcatum is a Apiaceae family herbal medicinal plant, which has the functions of soothing liver, relieving depression, relieving fever, dispelling stagnation, and regulating menstruation. B. falcatum roots have been used in Chinese herbal formbulary for at least 2000 years (Ahmadimoghaddam et al. 2021). In June 2021, infected leaves of B. falcatum that had dark brown, circular, elliptical or irregular shaped lesions or severely withered were obtained in Yichang (30.75 ° N，111.24 ° E), Hubei, China. Disease incidence was approximately 40% in the 20 hm2 B. falcatum plantation base. Fifteen small pieces (3 mm) were cut from the junction between disease and health of surface sterilized (with 75% alcohol) leaves and then plated on potato dextrose agar (PDA). After 3 days incubation, eight isolates with the same colony morphology were sub-cultured and purified by hyphal tip isolation. Isolate CHYB1 cultured on potato dextrose agar (PDA) was selected for identification. The colony was initially white and later producing gray and brown. Pycnidia were dark, spherical or flat spherical, and 78.3 to 137.4 µm in diameter. Conidia were oval mostly, smooth, aseptate, and 18 the size was 3.7 to 5.1 × 1.6 to 2.5 µm. Following DNA extraction, PCR was performed using the TSINGKE 2×T5 Direct PCR Mix kit. Target areas of amplification were the internal transcribed spacer (ITS) and beta-tubulin gene (TUB2) using ITS1/4 (White et al. 1990) Btu-F-F01/Btu-F-R01 primers (Wang et al. 2014), respectively. BLAST analysis of the ITS sequence (MZ818334.1) had 99% similarity to a 498 bp portion of D. glomerata sequence in GenBank (KR709012.1) and TUB2 sequence (OL439060) had 100% similarity to a 323 bp portion of D. glomerata sequence in GenBank (LT592974.1). All isolates (CHYB1-8) were taken for a pathogenicity test in laboratory on surface-disinfested leaves of B. falcatum. Mycelial plugs (5 mm) were excised from the margin of colony cultured for 5 days, and placed on surface-disinfested leaves of potted B. falcatum which involved creating small wounds. The potted plants were placed in a closed bucket to keep 80% relative humidity. Controls were inoculated with non-colonized PDA plugs (5 mm). All treatments had three replicates. On the inoculated B. falcatum, the leaves of B. falcatum appeared brown spot and been covered with off-white hyphae 7 DPI. By comparision, the control leaves had no symptoms. The pathogen was reisolated from the inoculated leaves and exhibited same morphological characteristics and ITS sequence as those of D. glomerata. D. glomerata was reported to cause round leaf spot on Sophora tonkinensis Gagnep and black spot disease of Actinidia chinensis in China (Pan et al. 2018; Song et al. 2020). To our knowledge, this is the first report of leaf spot caused by D. glomerata on B. falcatum in China.

First report of Fusarium equiseti causing bulb rot on lily (Lilium 'White planet' ) in China.

Lily (Lilium spp.) is one of the main ornamental plants grown in the world. In addition, bulbs of lily have been extensively used as edible and medicinal herbs in northern and eastern Asia, especially in China (Yu et al. 2015; China Pharmacopoeia Committee 2020; Tang et al. 2021). In August of 2021, a disease of stem and leaf rot was observed on lily cultivar 'White planet' with approximately 25% disease incidence in the greenhouse and fields at the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences (Beijing, China). The bulbs of symptomatic plants were brown and rotten, with sunken lesions. Symptomatic plants showed short, discolored leaves, and eventually lead to stem wilt and death of the whole plants. Infected bulbs were surface sterilized in 75% ethanol for 30 s, then in 2% sodium hypochlorite for 5 min, and rinsed three times with sterile distilled water. A 0.5×0.5 cm2 tissue piece was then placed on potato dextrose agar (PDA) medium and incubated at 25±1℃. After 5 days, the isolate was purified by single spore isolation technique. The singled-spored fungal colony was characterized by fluffy white aerial mycelia, and produced orange pigments with age. After seven days on Spezieller Nahrstoffarmer agar (SNA), conidia produced from simple lateral phialides. Macroconidia have pronounced dorsiventral curvature typical, significantly enlarged in the middle, a tapered whip-liked pointed apical cell and characteristic foot-shaped basal cell, 3 to 6 septate, measuring 18.71 to 43.01×2.89 to 5.56 µm with an average size of 26.98×3.90 µm (n=30). Microconidia were not observed. Typical verrucose thick chlamydospore with rough walls were profuse in chains or clumps, ellipsoidal to subglobose. These morphological characteristics were consistent with Fusarium spp. (Leslie et al. 2006). For molecular identification, the internal transcribed spacer (ITS), translation elongation factor subunit 1-alpha (TEF1-α) and RNA polymeraseⅡsubunit 2 (RPB2) genes were amplified using primers ITS1/ITS4, EF1/EF2 and 5F2/7cR respectively and sequenced (White et al. 1990; Jiang et al. 2018; O'Donnell et al. 2007). Sequences were submitted to GenBank under accession numbers OM078499 (ITS), Accession OM638086 (TEF1-α) and OM638085 (RPB2). BLAST analysis showed that ITS, TEF1-α and RPB2 sequences shared 100%, 99.8%, 99.2% identity to F. equiseti (OM956073, KY081599, MW364892) in GenBank, respectively. In addition, ITS, TEF1-α and RPB2 sequences shared 100%, 99.53%, 100% identity with Fusarium lacertarum (LC7927, Fusarium incarnatum-equiseti species complex) in the Fusarium-ID database. Based on the morphological characteristics and molecular sequences, the isolates were identified as Fusarium equiseti. A pathogenicity test was performed on potted lily ('White planet') under greenhouse conditions (25±1℃ with a 16 h light and 8 h dark cycle). Three healthy lily bulbs were selected and one bulb was planted in each pot filled with sterilized soil. Each pot was inoculated with 5 mL of conidia suspension (1×107 conidia/mL) in te soil around bulbs with a stem length of 3 cm, with an equal amount of sterilized water as a control. This test had three replicates. After 15 days of inoculation, typical symptoms of bulb rotten, like those observed in the greenhouse and fields, developed on the inoculated plants but not on the controls. The same fungus was consistently reisolated from the diseased plants. To our knowledge, this is the first report that F. equiseti caused bulb rot on Lilium in China. Our result should help with future monitoring and control of lily wilt disease.

Direct nitrogen, phosphorus and carbon exchanges between Mucoromycotina 'fine root endophyte' fungi and a flowering plant in novel monoxenic cultures.

Most plants form mycorrhizal associations with mutualistic soil fungi. Through these partnerships, resources are exchanged including photosynthetically fixed carbon for fungal-acquired nutrients. Recently, it was shown that the diversity of associated fungi is greater than previously assumed, extending to Mucoromycotina fungi. These Mucoromycotina 'fine root endophytes' (MFRE) are widespread and generally co-colonise plant roots together with Glomeromycotina 'coarse' arbuscular mycorrhizal fungi (AMF). Until now, this co-occurrence has hindered the determination of the direct function of MFRE symbiosis. To overcome this major barrier, we developed new techniques for fungal isolation and culture and established the first monoxenic in vitro cultures of MFRE colonising a flowering plant, clover. Using radio- and stable-isotope tracers in these in vitro systems, we measured the transfer of 33 P, 15 N and 14 C between MFRE hyphae and the host plant. Our results provide the first unequivocal evidence that MFRE fungi are nutritional mutualists with a flowering plant by showing that clover gained both 15 N and 33 P tracers directly from fungus in exchange for plant-fixed C in the absence of other micro-organisms. Our findings and methods pave the way for a new era in mycorrhizal research, firmly establishing MFRE as both mycorrhizal and functionally important in terrestrial ecosystems.

Natural occurrence of broad bean wilt virus 2 on Mirabilis jalapa in China.

Mirabilis jalapa Libosch. is an annual ornamental herbaceous plant. Its leaves and roots are used as a traditional folk medicine that function in clearing heat and detoxifying, promoting blood circulation, regulating menstruation, and nourishing kidney (Annapoorani et al. 2014; Liu et al. 2020; Wang et al. 2018). Broad bean wilt virus 2 (BBWV-2), which belongs to the family Secoviridae, is transmitted by aphid in a non-persistent manner in the nature (Kondo et al. 2005) and mainly damages Vicia faba, pepper, yam and spinach (He et al. 2021). The leaves of M. jalapa on the campus showed shrinking (Supplementary Fig. 1A), yellowing (Supplementary Fig. 1B), mosaic (Supplementary Fig. 1D & 1E), and the whole plant had stunted and rough (Supplementary Fig. 1A & 1C) symptoms in the autumn of 2021. Eight plants (S21-S28) with these symptoms were harvested for total RNA extraction, siRNA mixture purification, and siRNA library made (NEBNext® Ultra™ II RNA Library Prep Kit for Illumina®, NEB, UK). The high-throughput siRNA sequencing with pair-end method was performed on Illumina Hiseq 2000 platform (Sangon, Shanghai, China). The raw sequencing data was treated with the Illumina's CASAVA pipeline (version 1.8). The adaptor was removed and the reads were mostly distributed in 21-24 nt length area (Supplementary Fig. 2A). The contigs (∼12,500, Length > 350 bp) were obtained by de novo assembling with the Velvet Software 0.7.31 (k = 17), then the BLASTN was preformed against GenBank database. Surprisingly, 237 contigs showed significant nucleotide sequence similarities to the genome of BBWV-2. To determine the incidence of BBWV-2 to M. jalapa in campus garden, twenty-eight leaf samples were randomly collected from the garden. Leave extract and total RNA of the sample were tested for BBWV-2 by ELISA (Agdia, USA, SRA46202/0096) and RT-PCR assay, respectively. Twenty-two samples were infected compared with the positive control, and their readings of ELISA were above or parallel to the positive control (Supplementary Fig. 2B∼2D). The coding sequence (1,395 bp) of BBWV-2 movement protein (MP) was amplified by a specific pair of primers (Supplementary Table S1) according to the contigs, the results indicated that the 22 out of 28 samples (78.6%) tested positive for BBWV-2 by both ELISA and RT-PCR (Supplementary Fig. 2E). The MP fragment of BBWV-2 obtained from one of the sample was purified by TIANgel Midi Purification Kit (Tiangen, Beijing, China) and then cloned into pMD19-T (TaKaRa, Dalian, China) vector. Ten separate clones were selected and sequenced (Sangon, Shanghai, China) after PCR verification. The obtained sequences (GenBank accession No. OM416039) were analyzed by BLASTN and bioEdit software (version 7.2.3). According to the phylogenetic tree constructed by BBWV-2 MP sequences (Supplementary Fig. 3), the obtained MP sequences (OM416039, ON677747, and ON677748) were most related to the BBWV-2 MP sequences that from pepper (GenBank accession No. JX183228.1), they share the nucleotide identity of 84.87%. To determine the occurrence and distribution of BBWV-2 in other areas, another twenty-two samples were randomly collected for RT-PCR in different regions of Jiangsu Province, China (Supplementary Table S2). The BBWV-2 infection rate was 76.0% in the M. jalapa. In sum, this is the first report of BBWV-2 naturally infecting M. Jalapa in China.

First report of Leek yellow stripe virus, Onion yellow dwarf virus, and the putative allium polerovirus A in elephant garlic (Allium ampeloprasum) in Brazil.

Five elephant garlic plants (Allium ampeloprasum L.) showing leaf symptoms of chlorotic streaks and mosaic (Figure 1A and B) were collected, in September 2021, in an experimental area in municipality of Rio do Sul (27°11'07"S, 49°39'39"W), State of Santa Catarina, Brazil. Total RNA was extracted using TRIzol® reagent (Invitrogen, USA), according to the manufacturer's instructions to investigate viral infection. The RNA from all five plants were pooled into a single sample for cDNA library construction with the TruSeq Stranded Total RNA with Ribo-Zero Plant (Illumina) kit, which was then sequenced on the Illumina HiSeq2500 platform (Proteimax Biotechnology LTDA). After high throughput sequencing (HTS), 49 million raw reads (each 151nt) were generated. They were trimmed with the BBduk tool and de novo assembled with the Tadpole assembler tool (Geneious Software version 2022). A total of 28,345 contigs were generated and searched against the NCBI virus genome database using BLASTn and BLASTx, with positive results for two potyviruses, leek yellow stripe virus (LYSV), onion yellow dwarf virus (OYDV), and the putative polerovirus allium polerovirus A (APVA). The trimmed reads were mapped with the BBmap tool (Bushell 2014), using reference sequences for LYSV (NC_004011), OYDV (NC_005029), and APVA isolate Won (MH898527). A total of 806,060 reads were mapped, resulting in the nearly complete genome of LYSV (isolate RDS22-2, 10,268 bp, ON565071), which shared the highest (89.41%) nucleotide (nt) identity with LYSV isolate MG (KP258216). The nearly complete genome of OYDV (isolate RDS22-1, 10,519 bp, ON565070) was assembled using 311,467 reads, being 90.21% nt identical to OYDV isolate G-118 (KF632714). The APVA genome (isolate RDS22-3, 4,367 bp, ON565072, Figure 1C) was assembled from 116,303 reads and it shared the highest (90.73%) nt identity with APVA isolate Won. Subsequently, each sample was RT-PCR screened separately for potyviruses and poleroviruses, using the generic primer pairs NIb2F/NIb3R (Zheng et al., 2010) and Pol-G-F/Pol-G-R (Knierim et al., 2010), respectively. Amplified DNA fragments with approximately 350 bp and 1000 bp were obtained for potyviruses and poleroviruses, respectively, and were sent for Sanger sequencing (ACTGene, Alvorada, Brazil). The Sanger derived partial sequences shared 98 to 100% nt identities with corresponding HTS-derived sequences. The most common virus was LYSV, which was found in three of the five tested samples, whereas OYDV and APVA were only found in one sample each. The plants were also screened with specific primers for each virus, and none of the samples revealed mixed infections. Elephant garlic is primarily utilized for industrial garlic production in several countries, and it is now being researched in Brazil for the same purpose. It can be observed from this study that elephant garlic is susceptible to two of the most common viruses in garlic (LYSV and OYDV), which must be considered in the future while developing resistant varieties or in using thermotherapy and shoot tip/meristem culture to recover virus-free cultivars. LYSV and OYDV have already been described in Brazil infecting Allium sativum (Kitajima 2020). The only complete APVA sequence available is from China (Isolate Won), but no further characterization of the virus has been performed and published. The occurrence of this virus in Brazil highlights the importance of further research to obtain a more robust virus characterization.

Identification of Neofusicoccum parvum as the causative agent of leaf spot disease on Bletilla striata in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is an essential traditional Chinese medicinal plant used to treat hemorrhage, swelling, inflammation, ulcers, and pulmonary diseases (Xu et al. 2019). In April of 2020, an unknown leaf spot disease was observed on B. striata in a plantation (~ 0.2 ha) in Nanning, Guangxi province, China. Disease incidence was estimated at approximately 25% (n = 150 plants). The initial symptoms were small brown circular spots, which then expanded into reddish to brown, circular to irregular lesions 5-10 mm in diameter. As the disease developed, the whole leaf became densely covered with lesions. Finally, the lesions coalesced, killing the leaf and resulting in defoliation. To isolate the causal agent, six symptomatic leaves were collected from individual plants. Small pieces (~ 5 mm2) were cut from the margin of the necrotic lesions (n = 18), disinfected in 1% NaOCl for 2 min before rinsing three times in sterile water, and placed on potato dextrose agar (PDA) at 26°C for 3 days. Hyphal tips from the resulting cultures were transferred to PDA to obtain pure cultures. Fifteen isolates were obtained, of which twelve isolates exhibited similar morphology. Colonies on PDA were initially white, then turned dark gray after 7 days. Pycnidia were produced on the surface of PDA after 50 days. Conidia were hyaline, aseptate, ellipsoidal to fusiform, externally smooth, thin-walled, and measuring 11.5 to 15.2 × 4.9 to 6.1 µm (mean ± SD: 13.4 ± 1.0 × 5.4 ± 0.3 µm, n = 60). Morphological features were similar to N. parvum (Phillips et al. 2013). For further molecular identification, the internal transcribed spacer (ITS) region, partial translational elongation factor subunit 1-α (EF-1α), ß-tubulin (TUB2) genes were amplified and sequenced using the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F (Carbone and Kohn 1999)/EF-2 (O'Donnell et al. 1998), and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. Sequences of the two isolates BJ-111.1 and BJ-111.4 were deposited in NCBI GenBank under the following accession numbers: OM348509-10, OM397537-40. The obtained ITS, EF1-α, and TUB2 sequences showed 99% (514/516, and 513/516 bp), 99% (275/276, and 274/275 bp), and 99% (429/431, and 429/430 bp) homology with several GenBank sequences of the ex-type strain N. parvum CMW 9081 (AY236943, AY236888, and AY236917, respectively) (Zhang et al. 2017). In addition, a phylogenetic analysis confirmed the isolates as N. parvum. Therefore, the isolates were identified as N. parvum based on morphological and molecular evidence. Furthermore, pathogenicity tests were carried out on 1.5-year-old B. striata plants. Healthy leaves on six plants (1 leaf per plant) were inoculated with a 10-µl droplet of conidial suspensions (106 conidia/mL). Three plants treated with sterile water served as the control. All plants were covered with transparent plastic bags and incubated in a greenhouse at 26°C with a 12 h photoperiod. Six days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained healthy. The experiments repeated three times showed similar results. Finally, N. parvum was consistently re-isolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. No fungus was isolated from the controls. To our knowledge, this is the first report of N. parvum causing leaf spot of B. striata worldwide. This result will help develop disease management strategies against this pathogen.

First Report of Blight Caused by Rhizoctonia solani AG4-HGI on Pinellia ternata in Guizhou, China.

Pinellia ternata (Thumb.) has been used for over 1000 years as a traditional Chinese herbal medicine (Ying et al. 2007) and is widely cultivated in Guizhou Province, China. It is cultivated over an area of 2000 hectares, and is of great value to underdeveloped regions. In April 2020, blight was observed in a field of P. ternatain Bijie County, Guizhou Province, China (27°30'N, 105°28'E). Around 20 hectares of P. ternata were surveyed and the disease incidence ranged from 10 to 12%. The disease symptoms included light brown lesions formed on the stems near the soil line. The color of the lesions became darker, and the stems became constricted around the lesions and broke, associated with the leaf blight. To identify the causal agent of this blight, 22 diseased plants (about 30 d-old） were collected, the margins of the infected parts were cut into small pieces (5 mm) and surface disinfested with 1% NaOCl for 10 min, 75% ethanol for 30 s, and rinsed three times in sterile distilled water. The pieces were blotted dry with sterile filter paper and placed on potato dextrose agar (PDA, Hopebio, China), incubated at 28℃ in darkness until fungal hyphae growth was visible. Sixteen cultures with different morphologies were recovered from the samples. When representative isolates of each culture type were inoculated onto plants, one produced similar blight symptoms. The representative isolate was called CD-1. The colony color was first white but turned light brown after grown on PDA for 6-7 d, and produced dark brown sclerotia. The hyphae were branched at right angles, with a slight constriction at the base of the branches and a septum near the junction where the branch separates from the main hyphae. Hyphal cells were stained with 0.5% Safranin O and 3% KOH and were observed to be multinucleate. These morphological features indicated that CD-1 likely is R. solani (Sneh et al. 1991). When paired with tester strains AG1 and AG4(provided by Dr. Genhua Yang, Yunnan Agricultural University). CD-1 showed anastomosis with isolate of AG4 (Fenille et al. 2002). Genomic DNA was extracted from the isolate (Thangaraj et al. 2018) using a fungal genomic DNA extraction kit (Tiangen, China). The internal transcribed spacer (ITS) regions were amplified using the primers ITS1/ITS4 (White et al. 1990). A 535 bp fragment was amplified that showed 99% coverage and 99.4% identity with an isolate of R. solani AG4-HGI (GenBank: HG934417). The gene sequence was deposited in GenBank as accession #OL518945. Pathogenicity tests were performed using 30 d-old plants planted in sterilized soil in pots. Cut mycelial discs (diameter 6 mm) from 3-day-old PDA cultures and placed beside stems of 21 healthy plants. Nine plants treated with agar plugs were control samples. Inoculated plants were maintained at 24 ± 5℃ in a green house and watered every two days with sterilized water. Typical blight symptoms developed on the inoculated plants at d 3-5 post inoculation, whereas the control plants remained healthy. The experiments were repeated three times, and the isolates was re-isolated from the inoculated plants and identified as R. solaniAG4 by morphological features and molecular method. R. solani has been reported to cause blight of many plants such as coffee (Ren et al. 2018) and sesame (Cochran et al. 2018). To the best of our knowledge, this is the first report of R. solani AG4-HGI causing disease on P. ternate, both in China and worldwide. This finding suggests that this pathogen may cause a threat to cultivation and production of P. terenata.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

Occurrence of Leaf Spot Caused by Diaporthe phaseolorum on Bletilla striata in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is a traditional Chinese medicinal plant widely distributed in eastern and southern Asia. In April of 2020, a leaf spot disease on B. striata was observed in plant nurseries in Guilin, Guangxi Province, China. Disease incidence was estimated at approximately 20% (n = 150 plants) across the survey area (~ 0.3 ha). The initial symptoms were small, reddish to brown spots, circular or irregular in shape. Subsequently, they developed into large dark brown, irregular lesions. As the lesions coalesced, leaves withered and defoliated. To isolate the causal agent, eighteen small pieces (~ 5 mm2) were collected from the margin of the necrotic lesions on Chinese ground orchid, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and placed on potato dextrose agar (PDA) at 26°C for 3 days. Hyphal tips were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which eight isolates had similar morphological characteristics. After 7 days growth on PDA, colonies were grayish-white, fluffy, with white aerial mycelium. After 3 weeks, colonies formed white aerial mycelial mats, and pycnidia developed. The α-conidia were abundant, hyaline, aseptate, ellipsoidal to fusiform, measuring 4.6 to 6.7 µm × 2.1 to 3.0 µm (n = 55), whereas the ß-conidia were hyaline, long, slender, straight or curved, measuring 10.3 to 17.2 µm × 0.9 to 1.8 µm (n = 59). Morphological features were similar to Diaporthe sp. (Santos et al. 2011, Udayanga et al. 2015). For further molecular identification, DNA was extracted from the mycelia of the representative isolate BJ26.3 following the CTAB (cetyltrimethylammonium bromide) method (Guo et al. 2000). The internal transcribed spacer (ITS) region, partial translational elongation factor subunit 1-α (EF-1α), calmodulin (CAL) , histone H3 (HIS3), ß-tubulin (TUB) genes were amplified and sequenced using the primer pairs ITS1/ITS4, EF1-728F/EF1-986R, CAL-228F/CAL-737R, CYLH3F/H3-1b, and Bt2a/Bt2b, respectively (White et al. 1990, Guarnaccia et al. 2018). The obtained sequences were deposited in NCBI GenBank under the following accession numbers: OK560457, OK539595, OK539592, OK506726, OK539598. BLAST analysis of the deposited sequences showed 99 to 100% identity with accession numbers KC343177 (563/566 bp), KC343903 (521/523 bp), KC343419 (423/427 bp), KC343661 (340/340 bp), KC344145 (658/662 bp) of D. phaseolorum CBS 127465 (Guarnaccia et al. 2018). In addition, a phylogenetic analysis using concatenated sequences confirmed BJ26.3 as D. phaseolorum. Furthermore, pathogenicity tests were carried out on 1.5-year-old B. striata plants. Healthy leaves on three plants (1 leaf per plant) were inoculated with 5 × 5 mm mycelial discs of strain BJ-26.3 from 3-day-old PDA cultures. Another three plants treated with sterile water served as the control. All plants were covered with transparent plastic bags and maintained in a greenhouse at 26°C with a 12 h photoperiod. Nine days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained healthy. The experiments repeated three times showed similar results. Finally, D. phaseolorum was consistently re-isolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. To our knowledge, this is the first report of D. phaseolorum causing leaf spot of B. striata worldwide. This study might provide important information for growers to manage this disease.

First Report of Neopestalotiopsis cubana Causing leaf blight on Ixora chinensis in Malaysia.

Ixora chinensis (family Rubiaceae), locally known as 'Bunga Jejarum', is widely grown as an ornamental shrub and as sources for phytochemicals with medicinal properties in Malaysia. In May 2021, irregular brown spots were found on the leaves of some 'Bunga Jejarum' in Universiti Malaysia Sabah (6°02'01.0"N 116°07'20.2"E) located in Sabah province. As the disease progressed, the spots enlarged and coalesced into large necrotic areas giving rise to drying of infected leaves. The disease severity was about 70% with 20% incidence. Five symptomatic leaves (5 x 5 mm) from five plants were excised and sterilized based on Khoo et al. (2022) before plated on five potato dextrose agar (PDA) and cultured at 25°C. After 5 days, white to pale honey and dense mycelia with lobate edge were observed on all PDA plates. Globose, black conidiomata semi-immersed on PDA were observed after a week. Two to four hyaline filamentous appendages 7.7 to 17.6 µm long attached to fusoid conidia (11.8 to 20.9 x 5.7 to 7.6 µm, n = 20), which consisted of a hyaline apical cell, basal cell, and three versicolored median cells. The upper two median cells were dark brown, while the lowest median cell was pale brown. The isolate of the causal pathogen was characterized molecularly. Genomic DNA of isolate UMS01 was extracted based on Khoo et al. (2021) and Khoo et al. (2022). Amplification of the internal transcribed spacer (ITS), tubulin (TUB) and translation elongation factor 1-α (TEF) region was performed based on Khoo et al. (2022) using primers ITS1/ITS4 (White et al. 1990), T1/Bt2b (Glass and Donaldson, 1995; O'Donnell and Cigelnik, 1997) and EF1-728/EF2 (O'Donnell et al. 1998; Carbone and Kohn, 1999), respectively. PCR products with positive amplicons were sent to Apical Scientific Sdn. Bhd. for sequencing. The isolate's sequences were deposited in GenBank as OM320626 (ITS), OM339539 (TUB) and OM339540 (TEF). They were 99% to 100% identical to ITS(KM199347) (545 out of 545 bp), TUB (KM199438) (768 out of 769 bp) and TEF (KM199521) (480 out of 481 bp) of the type sequences (CBS 600.96). Phylogenetic analysis using the maximum likelihood method based on the combined ITS, TEF and TUB sequences placed the isolate UMS01 in the same clade as the isolate CBS 600.96 of Neopestalotiopsis cubana. Thus, the pathogen was identified as N. cubanabased on the morphological description from Pornsuriya et al. (2020), molecular data in Genbank database and multigene sequence analysis. To further confirm its pathogenicity, the first and second leaves of three 'Bunga Jejarum' plants were inoculated by pipetting 1 ml aliquots of a 1 × 106 conidia/ml spore suspension. Three additional 'Bunga Jejarum' plants were mock inoculated by pipetting 1 ml of sterile distilled water on similar age leaves. The plants were covered with plastic bags after inoculation for 48 h before placing them in a glasshouse under room temperature. The leaves were sprayed with water to keep the leaf surfaces moist along the experiment. The incubation and disease observation were performed based on Chai et al. (2017) and Iftikhar et al. (2022). After 7 days post-inoculation, all infected leaves exhibited the symptoms observed in the field, whereas the controls showed no symptoms. The same fungus was isolated from the diseased leaves and, thus confirmed Koch's postulates. The experiment was repeated two more times. The reisolated fungi were visually and genetically identical to the original isolate obtained from the field samples. To our knowledge, this is the first report of N. cubana causing leaf blight on 'Bunga Jejarum' in Malaysia, as well as the world. Our finding has broadened the distribution and host range of N. cubana, indicating that it poses potential damage to the medicinal plant Bunga Jejarum in Malaysia.

First Report of Seedling Stem Rot on Jinxianlian (Anoectochilus roxburghii) Caused by Fusarium oxysporum in China.

Anoectochilus roxburghii is an important Chinese herbal medicine plant belonging to Orchidaceae and known as Jinxianlian. This orchid is cultivated and mostly adopted to treat diabetes and hepatitis. About 2 billion artificially cultivated seedlings of Jinxianlian are required each year and approximately $600 million in fresh A. roxburghii seedlings is produced in China. From 2011, sporadic occurrence of stem rot on Jinxianlian have been observed in greenhouses in Jinhua City (N29°05', E119°38'), Zhejiang Province. In 2018, nearly 30% of seedlings of Jinxianlian grown in greenhouse conditions were affected by stem rot in Jinhua City. Symptoms initially occurred in the stem at the soil line causing dark discoloration lesions, rotted tissues, wilting, and eventually leading to the death of the plants. A total of 23 diseased seedlings collected from seven different greenhouses were surface sterilized with 1.5% sodium hypochlorite for 3 min, then rinsed in water. Pieces of tissues disinfected from each sample were plated on 2% potato dextrose agar (PDA), and incubated at 25°C in the dark for 5 days (Kirk et al. 2008). A total of 19 isolates were recovered. They developed colonies with purple mycelia and beige or orange colors after 7 days of incubation under 25°C on PDA and carnation leaf agar (CLA) media (Kirk et al. 2008; Zhang et al. 2016). Colonies on PDA had an average radial growth rate of 3.1 to 4.0 mm /d at 25°C. Colony surface was pale vinaceous, floccose with abundant aerial mycelium. On CLA, aerial mycelium was sparse with abundant bright orange sporodochia forming on the carnation leaves. Microconidia were hyaline and oval-ellipsoid to cylindrical (3.7 to 9.3 × 1.3 to 2.9 µm) (n=19). Macroconidia were 3 to 5 septate and fusoid-subulate with a pedicellate base (27.4 to 35.6 × 3.2 to 4.2 µm) (n=19). These morphological features were consistent with Fusarium oxysporum (Sun et al. 2008; Lombard et al., 2019). To confirm the identification based on these morphological features, the internal transcribed spacer region (ITS) and translation elongation factor1 (TEF) were amplified from the DNA of 3 out of 19 isolates chosen at random respectively using the set primer ITS1/ITS4 and EF1/ EF2 (Sun, S., et al. 2018; Lombard et al., 2019). BLAST analysis revealed that the ITS sequences (OK147619, OK147620, OK147621) had 99% identity to that of F. oxysporum isolate JJF2 (GenBank MN626452) and TEF sequence (OK155999, OK156000, OK156001) had 100% identity to that of F. oxysporum isolate gss100 (GenBank MH341210). A multilocus phylogenetic analysis by Bayesian inference (BI) and maximum likelihood (ML) trees based on ITS and TEF indicated that the pathogen grouped consistently with F. oxysporum. Three out of 19 isolates chosen at random were selected to evaluate pathogenicity. Uninfected healthy A. roxburghii seedlings about 40 day-old planted in sterilized substrates were sprayed with distilled water containing 2 x 106 conidia per ml suspensions as inoculums, and plants sprayed with distilled water alone served as controls. Plants were then incubated at 25°C and 85% relative humidity. Ten plants were inoculated for each isolate. After 10 days, all plants inoculated developed stem rot symptoms, while control plants remained healthy. Cultures of Fusarium spp. were re-isolated only from inoculated plants with the frequency of 100% and re-identified by morphological characteristics as F. oxysporum, fulfilling Koch's postulates. To the best of our knowledge, this is the first report of F. oxysporum causing stem rot on A. roxburghii seedlings. As F. oxysporum is a devastating pathogenic fungus with a broad host range, measures should be taken in advance to manage stem rot of A. roxburghii.

From birth to function: Male gametophyte development in flowering plants.

Male germline development in flowering plants involves two distinct and successive phases, microsporogenesis and microgametogenesis, which involve one meiosis followed by two rounds of mitosis. Many aspects of distinctions after mitosis between the vegetative cell and the male germ cells are seen, from morphology to structure, and the differential functions of the two cell types in the male gametophyte are differentially needed and required for double fertilization. The two sperm cells, carriers of the hereditary substances, depend on the vegetative cell/pollen tube to be delivered to the female gametophyte for double fertilization. Thus, the intercellular communication and coordinated activity within the male gametophyte probably represent the most subtle regulation in flowering plants to guarantee the success of reproduction. This review will focus on what we have known about the differentiation process and the functional diversification of the vegetative cell and the male germ cell, the most crucial cell types for plant fertility and crop production.

First Report of Anthracnose on Bletilla striata Caused by Colletotrichum fructicola in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is a traditional Chinese medicinal plant. In April 2018 and 2019, a leaf spot disease was observed on ∼20% of B. striata plants in two fields (∼1.4 h) in Guilin, Guangxi Province, China (Fig.1 A). Small, circular, brown spots were initially observed on the leaf surfaces, which progressively expanded into large, sunken, dark brown, necrotic areas. As the disease progressed, lesions merged into large, irregular spots, ultimately resulting in abscission. To determine the causal agent, small pieces (5 mm x 5 mm) were collected from the infected leaf tissues (n = 18), surface sterilized in 1% NaOCl for 2 min, and rinsed three times with sterile water. Then, the tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/L) and incubated under 12 h photoperiod at 26°C for 3 days. Seventeen isolates were obtained, of which twelve isolates with similar morphological characteristics were obtained from the germinated spores on PDA. Seven-day-old colonies on PDA appeared cottony, pale white to pale gray from above, and grayish-green from below. Conidia of strain BJ-101.3 were hyaline, aseptate, straight, and cylindrical, with rounded ends (Fig.1 E-G), measuring 11.3 to 15.9 µm × 4.0 to 6.4 µm (n = 50). Appressoria were brown to dark brown, with different shapes and a smooth edge (Fig.1 H-I), measuring 6.3 to 10.0 µm × 4.1 to 8.0 µm (n = 50). Morphological features were similar to C. gloeosporioides species complex (Weir et al. 2012, Fuentes-Aragón et al. 2018). For molecular identification, DNA was extracted from two isolates BJ-101.3 and BJ-101.13, following the CTAB method (Guo et al. 2000). The internal transcribed spacer (ITS) region, partial actin (ACT), calmodulin (CAL), chitin synthase (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), manganese superoxide dismutase (SOD2), beta-tubulin (TUB2), glutamine synthetase (GS), and Apn2-Mat1-2 intergenic spacer and partial mating-type (ApMat) genes were amplified by PCR and sequenced (Weir et al. 2012, Silva et al. 2012, Vieira et al. 2017). The obtained sequences were deposited in GenBank (MW386818, MW386819, MW403508 to MW403519, and MW888410 to MW888413). BLASTN analysis of the obtained sequences showed 99% identity with those of C. fructicola (JX010165，JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405, JQ807838) (Weir et al. 2012, Liu et al. 2015). A phylogenetic tree based on the concatenated sequences confirmed the isolates as C. fructicola (Fig.2). Furthermore, pathogenicity tests were conducted on six 1.5-year-old B. striata plants. Healthy leaves on the plants were inoculated with the conidial suspensions (106 conidia/mL; 10 µL) of the strains BJ-101.3 and BJ101.13. The conidial suspension of each isolate was inoculated onto at least three leaves. Another three plants inoculated with sterile water served as the control. All plants were covered with transparent plastic bags and incubated in a greenhouse at 26°C for 14 days with a 12 h photoperiod. Nine days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained symptomless (Fig.1 B-C). The experiments repeated three times showed similar results. Finally, C. fructicola was consistently reisolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. The outcome of this study will help in developing effective management measures against anthracnose of B. striata.

First report of Meloidogyne arenaria on roots of Grona triflora in Guangdong Province, China.

Grona triflora (Desmodium triflorum), a perennial herbaceous legume, is widely distributed in southern China. G. triflora has antipyretic, antiseptic and expectorant properties and can therefore be used as a phytomedicine (Ghosal et al. 1973). In July 2020, roots of G. triflora were investigated for nodules and rhizobia collection at the Shibaluohan Mountain Forest Park of Guangzhou. Root galls induced by a root-knot nematode were observed on 90% of the G. triflora samples (in a 200 m2 plot) and the infested plants had yellow, small and withered leaves compared with the healthy ones. The galls number on a G. triflora root ranged from 43 to 92 and the population densities of second stage juveniles (J2s) ranged from 573 to 894 per 100 cm3 soil surrounding the plant. The female perineal patterns showed a low dorsal arch, with lateral field marked by forked and broken striae, no punctate markings between the anus and tail terminus, which matched with the description of Meloidogyne arenaria (Hartman and Sasser 1985). The J2s had the following morphometric characters (n = 15): body length = 501.05 ± 23.71 µm; body width = 17.14 ± 1.23 µm; DGO = 3.13 ± 0.27 µm; stylet length = 12.97 ± 1.38 µm; tail length = 58.02 ± 4.77 µm; hyaline tail terminus = 10.08 ± 0.65 µm. DNA from four female nematodes was isolated for PCR-based diagnostic analyses. A fragment between the COII and LrRNA genes of the mitochondrial DNA was amplified with primers C2F3/1108 (Powers and Harris 1993). In addition, a 28S ribosomal DNA D2/D3 region was amplified with primers MF/MR (Hu et al. 2011). The amplicons were sequenced (GenBank No. MW315989 and MW307358). Nucleotide BLAST results indicated that both sequences show 100% identity with corresponding M. arenaria sequences of isolates from various countries such as Brazil, China, Myanmar and Vietnam (e.g., MK033428, JQ446377, KY293688 and MK026624). For further confirmation, sequence characterized amplified region (SCAR) PCR was employed using the M. arenaria specific primers Far/Rar (Zijlstra et al. 2000). The amplicon was also sequenced (GenBank No. MW315990). The Nucleotide BLAST results showed >99% identity with M. arenaria isolates from Indonesia and Argentina (KP234264, KP253748 and MK015624). Greenhouse tests were conducted to analyze the capacity of M. arenaria to induce galls on G. triflora roots. The G. triflora seeds were collected from the sampling plot and germinated on 0.8% (W/V) agar plates. Then the seedlings were planted in 14 cm deep and 15 cm diam pots filled with sterilized soil from sampling plot. Every seedling was inoculated with 2,000 J2s (n = 15) and plants without J2s were used as a control. Two months later, galls were observed for inoculated roots while no galls were formed on roots of control plants. An average of 13,300 J2s and eggs of M. arenaria (reproduction factor = 6.65) were recovered from the root. Stanton and Rizo (1988) found that G. triflora was susceptible to M. javanica in Australia, and Ogbuji (1978) reported that a population of M. incognita reproduced on roots of G. triflora in Nigeria after artificial inoculation. To our knowledge, this is the first report on G. triflora parasitized by M. arenaria in Guangdong province. M. arenaria has potential to infest local, economically important plants like citrus, pomelo, sugarcane, maize and peanut. As G. triflora is widely distributed in southern China, there is the risk of spreading M. arenaria into agricultural and horticultural systems, that will cause yield loss and economic impacts.

Occurrence of Powdery Mildew Caused by Erysiphe buhrii on Dianthus chinensis in Inner Mongolia, China.

Dianthus chinensis is widely cultivated for ornamental and medicinal use in China (Guo et al. 2017). The plant has been used in traditional Chinese medicine for the treatment of urinary problems such as strangury and diuresis (Han et al. 2015). In June and July 2020, powdery mildew-like signs and symptoms were seen on leaves of D. chinensis cultivated on the campus of Inner Mongolia Agricultural University, Hohhot city, Inner Mongolia Province, China. White powder-like masses occurred in irregular shaped lesions on both leaf surfaces and covered up to 50% of leaf area. Some infected leaves were deformed on their edges and some leaf senescence occurred. More than 40 % of plants (n = 180) exhibited these signs and symptoms. Conidiophores (n = 50) of the suspect fungus were unbranched and measured 70 to 140 µm long × 6 to 10 µm wide and had foot cells that were 25 to 48 µm long. Conidia (n = 50) were produced singly, elliptical to cylindrical shaped, 30 to 45 µm long × 12 to 19 µm wide, with length/width ratio of 2.0 to 3.2, and lacked fibrosin bodies. No chasmothecia were found. Based on these morphological characteristics, the fungus was tentatively identified as an Erysiphe sp. (Braun and Cook 2012). Fungal structures were isolated from diseased leaves and genomic DNA of the pathogen extracted utilizing the method described by Zhu et al. (2019). The internal transcribed spacer (ITS) region was amplified by PCR employing the primers PMITS1/PMITS2 (Cunnington et al. 2003) and the amplicon sequenced by Invitrogen (Shanghai, China). The sequence for the powdery mildew fungus (deposited into GenBank under Accession No. MW144997) showed 100 % identity (558/558 bp) with E. buhrii (Accession No. LC009898) that was reported on Dianthus sp. in Japan (Takamatsu et al. 2015). Pathogenicity tests were done by collecting fungal conidia from infected D. chinensis leaves and brushing them onto leaves of four healthy plants. Four uninoculated plants served as controls. Inoculated and uninoculated plants were placed in separate growth chambers maintained at 19 ℃, 65 % humidity, with a 16 h/8 h light/dark period. Nine-days post-inoculation, powdery mildew disease signs appeared on inoculated plants, whereas control plants remained asymptomatic. The same results were obtained for two repeated pathogenicity experiments. The powdery mildew fungus was identified and confirmed as E. buhrii based on morphological and molecular analysis. An Oidium sp. causing powdery mildew on D. chinensis previously was reported in Xinjiang Province, China (Zheng and Yu 1987). This, to the best of our knowledge, is the first report of powdery mildew caused by E. buhrii on D. chinensis in China (Farr and Rossman 2020). The sudden occurrence of this destructive powdery mildew disease on D. chinensis may adversely affect the health, ornamental value and medicinal uses of the plant in China. Identifying the cause of the disease will support efforts for its future control and management.

First report of Epicoccum sorghinum causing leaf spot on Hemerocallis citrina in China.

Hemerocallis citrina Baroni, also called yellow flower vegetable (huang hua cai in Chinese), is belonging to the family Xanthorrhoeaceae and is widely planted in China, the Korea Peninsula and Japan for ornamental purposes and vegetable value. In addition, they could also be used as a traditional Chinese medicinal and modern medicinal plant (Du et al. 2014). In August 2019, a leaf spot disease was observed on H. citrina plants in Zhejiang Province of China, with approximately 85% incidence in almost 700 ha. Symptoms were firstly displayed as small, water-soaked, pale chlorotic spots, with yellow halos enlarged into large fusiform spots with brown edge and gray centers. Later, infected leaves were badly damaged and became wilted. Small pieces of infected tissue were excised from the margin of necrotic lesions, surface disinfected with 70% ethanol for 8s, 0.1% HgCl2 for 1 min, rinsed with sterile distilled water for three times, and incubated on potato dextrose agar (PDA, amended with 100 mg/L streptomycin sulfate) at 26°C in the dark. Fungal colonies with similar cultural morphology were consistently obtained from repeated isolations. When cultured on PDA, colonies were villose, regular, grayish-green, and turned gray-brown, with the reverse side became reddish-brown. Chlamydospores were gray, unicellular or multicellular, nearly spherical, 11 to 27 × 10 to 23 µm. Pycnidia and conidia were produced on PDA when the fungal colonies were exposed to ultraviolet light for 12 h with a distance of 40 cm to the late source. Pycnidia were brown, mostly spheroid, and measured 90 to 138 × 120 to 210 µm. Conidia were hyaline, ellipsoidal, unicellular, aseptate, 4.3 to 5.5 × 1.8 to 2.4 µm. These morphological characteristics agreed with the descriptions of Epicoccum sorghinum (Zhou et al. 2018). The DNA of a representative strain HHC6-2 was extracted using CTAB method and the rDNA internal transcribed spacer (ITS), actin (ACT) and ß-tubulin (TUB) genes were amplified and sequenced, using the primers ITS4/ITS5 (White et al. 1990), ACT512F/ACT783R (Carbone and Kohn 1999) and Bt-1/Bt-2 (Glass and Donaldson 1995), respectively. BLASTn searches of the resulting ITS, ACT and TUB sequences (accession nos. MW073403, MW080522, MW080521) revealed 98.58 to 100% identity to the E. sorghinum sequences (MT125854, MN956831 and MF987525). The pathogenicity test was carried out by inoculation of potted H. citrina plants using conidial suspensions. H. citrina seedlings were planted in pots with sterilized soil. Before inoculation, leaves were surface-disinfected with 70% ethanol and sterile distilled water. Leaves were inoculated by placing small droplets of conidial suspensions (105 conidia/ml) on one side of the midvein, and 3 to 5 drops were used per leaf. Sterile water was used as control. All the inoculated plants were placed in humid chambers at 25°C for 48h, and then maintained in a greenhouse at 25°C with a 16 h day-8 h night cycle. The pathogenicity assays were performed twice with three replications. Four days after inoculation, yellow to brown spots resembling those observed in the fields developed on the inoculated leaves. However, no symptoms were observed on the controls. E. sorghinum was re-isolated and identified based on morphological and molecular techniques as described above. To our knowledge, this is the first report of E. sorghinum causing leaf spot on H. citrina. It seems to be a threat for H. citrina planting in China and should be considered in order to reduce losses caused by this disease. This study might provide the basis for diagnosis and control of the disease.